Copyright © 2007 The American Society of Human Genetics. All rights reserved.
The American Journal of Human Genetics, Volume 81, Issue 6, 1232-1250, 1 December 2007
doi:10.1086/522238
Article
Sonja C. Vernesa, b, Elizabeth Spiteric, Jérôme Nicoda, Matthias Groszera, Jennifer M. Taylora, Kay E. Daviesb, Daniel H. Geschwindc, d and Simon E. Fishera,
, 
a Wellcome Trust Centre for Human Genetics University of Oxford, Oxford, United Kingdom
b Medical Research Council Functional Genetics Unit University of Oxford, Oxford, United Kingdom
c Program in Neurogenetics, Department of Neurology, University of California–Los Angeles (UCLA), Los Angeles
e and Semel Institute and Department of Human Genetics, David Geffen School of Medicine at UCLA Los Angeles
Address for correspondence and reprints: Dr. Simon E. Fisher, Wellcome Trust Centre for Human Genetics, The University of Oxford, Roosevelt Drive, Oxford, OX3 7BN, United KingdomNeurodevelopmental disorders that disrupt language acquisition tend to be complex at the genetic level, potentially involving a large number of different susceptibility loci, such that identification of the relevant molecular pathways remains challenging.1, 2 In earlier studies, we discovered that heterozygous mutations of the human FOXP2 gene (MIM 605317) are responsible for a rare monogenic communication disorder, primarily characterized by difficulties in learning to make the coordinated sequences of articulatory gestures that underlie speech (developmental verbal dyspraxia [MIM 602081]).3, 4 The disorder also involves deficits in many aspects of linguistic processing, affecting both oral and written abilities, across expressive and receptive domains.5 To date, speech and language impairments have been documented in two different multigenerational families segregating missense and nonsense point mutations of FOXP2,3, 4 as well as in several cases of gross chromosomal rearrangements (translocations and deletions) that disturb the integrity of the FOXP2 genomic locus in 7q31.3, 6, 7, 8 People who are affected with Silver-Russell syndrome (MIM 180860), associated with uniparental disomy of the maternal copy of chromosome 7, can also display verbal dyspraxia, which appears to relate to reductions in FOXP2 expression.6
FOXP2 encodes a regulatory protein belonging to the forkhead-box (FOX) group of transcription factors.3 Members of this class of protein share a distinctive type of DNA-binding motif, the FOX domain, and are prominent regulators of eukaryotic gene expression, associated with a wide variety of cellular and developmental processes.9 FOX gene dysfunction has been implicated in a range of disease states, including developmental eye disorders, ovarian failure, immune deficiency, and carcinogenesis.10, 11 Several FOX transcription factors are key players in CNS development; for example, Foxg1 regulates proliferation and differentiation of progenitor cells of the telencephalon,12 whereas Foxb1 is critical for normal development of diencephalon and midbrain.13 FOXP2 itself belongs to a functionally divergent subgroup of the FOX proteins, characterized by a shorter DNA-binding domain and the presence of other defining motifs, including glutamine-rich stretches, dimerization domains, and an acidic C-terminus.14
Much of our current knowledge of the neural correlates of FOXP2 disruption comes from intensive phenotypic studies of a single human family (the “KE” family) in which 15 people have verbal dyspraxia due to a missense mutation in the FOX domain.3 The mutation in this family is associated with bilateral abnormalities in gray-matter density, including significant decreases in the inferior frontal gyrus (including Broca’s area), caudate nucleus, and cerebellum and increases in the posterior temporal gyrus (including Wernicke’s area), angular gyrus, and putamen,15 as well as altered patterns of neural activity during linguistic processing.16 Intriguingly, the neural sites of structural and/or functional abnormalities in the KE family are concordant with regions of high FOXP2 expression in the developing human brain.17 We recently used human cell lines to demonstrate that the KE family's missense mutation and a nonsense mutation causing verbal dyspraxia in a second multiplex family4, 18 dramatically interfered with transcription factor function.18
Overall, the combined findings from phenotypic evaluation, neuroimaging studies, expression analyses, and functional genetic assays suggest that a reduced dosage of functional FOXP2 has an impact on the development and function of a subset of distributed neural circuits, including those important for speech and language acquisition. Thus, the FOXP2 gene provides a unique molecular window into the neural basis of human communication.19 In particular, its role as a transcription factor, modulating the expression of target genes, offers elegant functional genomic routes for dissecting the associated neurogenetic pathways. However, at present, there are no neural targets of FOXP2 reported in the literature.
The aim of the present study was to discover downstream targets directly regulated by FOXP2 in neurons, by exploiting emerging strategies based on the chromatin-immunoprecipitation (ChIP) method. This is a powerful technique for studying protein-DNA interactions inside the nucleus under physiological conditions,20 allowing characterization of genomic sites bound by a protein of interest in the native chromatin of living cells. Here, we develop FOXP2 ChIP, couple it to high-throughput screening of microarrays (ChIP-chip), and identify occupied promoters in native chromatin of human neuron-like cells. We focus on a subset of targets uncovered via this approach, demonstrating that altered FOXP2 levels yield significant changes in their expression and that FOXP2 binds in a specific manner to consensus sites within the relevant promoters. Finally, we identify significant quantitative differences in target expression in the embryonic brains of mutant mice, mediated by specific in vivo Foxp2-chromatin interactions. This work, along with that of Spiteri et al.,21(in this issue) represents the first identification and validation of neural targets regulated by FOXP2 and suggests roles for this gene in modulating synaptic plasticity, neurodevelopment, neurotransmission, and axon guidance.
SH-SY5Y cells were grown in Dulbecco's modified Eagle medium (DMEM):F12 media (Sigma), and HEK293T cells in DMEM media (Sigma). Media was supplemented with 10% fetal calf serum (Sigma), 2 mM l-glutamine (Sigma), and 2 mM penicillin/streptomycin (Sigma). Cells were grown at 37°C in the presence of 5% CO2. Stable SH-SY5Y cell lines overexpressing FOXP2 or nonexpressing controls were generated by transfection with pcDNA3.1/FOXP2 (isoform I–untagged) or the empty vector, respectively, by use of Lipofectamine Plus (Invitrogen) in accordance with the manufacturer's instructions. Cells were cultured in complete medium supplemented with 500 βg/ml G418 (Calbiochem) as a selective agent. Resistant single colonies were isolated 20 d after transfection and then were cultured and expanded independently in the presence of G418 (500 βg/ml). Quantitative RT-PCR (qRT-PCR) (see “ qRT-PCR” section) and western blotting (performed as described elsewhere18) confirmed expression of recombinant FOXP2. A clone with a high and consistent level of expression was chosen for use in further experiments. Transient transfections of SH-SY5Y or HEK293T cells were performed using Transfast (Promega) or GeneJuice (Novagen) transfection reagents, respectively, in accordance with the manufacturer's instructions and were harvested 48 h after transfection. FOXP2 detection was performed using N-terminal (Santa Cruz Biotechnology) or C-terminal (Serotec) goat polyclonal antibodies.18
SH-SY5Y cells stably expressing FOXP2 isoform I were cross-linked using 1% formaldehyde in cross-linking buffer (50 mM HEPES, 100 mM NaCl, 1 mM EDTA, and 0.5 mM ethylene glycol tetraacetic acid [EGTA]) at room temperature. Cells were incubated for 10 min in ice-cold ChIP lysis buffer (10 mM Tris, 0.25% Triton X-100, 10 mM EDTA, 0.5 mM EGTA, and protease inhibitors) and were centrifuged at 10,000 g at 4°C for 5 min to pellet nuclei. Nuclei from 3×107 cells were resuspended in 1 ml Sonication Buffer (10 mM Tris, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, and protease inhibitors) with 0.1 g of 212–300-βm glass beads (Sigma) before undergoing 10 rounds of 20-s sonication pulses at 65% power, with 2 min on ice between each round (with use of Bandelin SONOPULS HD2070 Ultrasonic Homogenisor and MS72 2-mm titanium tip with 200-βm SS amplitude). Cells were centrifuged at 10,000 g at 4°C for 5 min to remove glass beads and cell debris. Then, 1 βg of FOXP2 N-terminal antibody (Santa Cruz Biotechnology) was incubated with the sonicated supernatants in IP buffer (0.1 M Tris, 10 mM EDTA, 150 mM NaCl, 0.2 % Triton X-100, 1% phenylmethylsulfonyl fluoride, and protease inhibitors), rotating overnight at 4°C. Immune complexes were captured by addition of 5 βg sonicated salmon sperm DNA and 50 βl Protein G–sepharose beads, incubated for 3 h at 4°C. Protein was eluted from beads first by 1.5% SDS buffer (1.5% SDS, 1× TE [pH 7.5], and 30 mM NaCl) and then by 0.5% SDS buffer (0.5% SDS, 1× TE [pH 7.5], and 30 mM NaCl), with incubation of the beads with each in turn at room temperature for 15 min. Pooled supernatants were incubated at 65°C overnight to reverse cross-links. DNA was isolated via phenol-chloroform extraction followed by ethanol precipitation. Concentration and purity of the DNA was evaluated by spectrophotometry, and size was assessed via gel electrophoresis. Protein samples were extracted in parallel via precipitation with use of trichloroacetic acid (Sigma), and western blotting was used to confirm immunoprecipitation of the FOXP2 protein.
In vivo Foxp2 ChIP with use of embryonic brains from wild-type or homozygous mutant mice was performed according to the protocol described by Spiteri et al.21(in this issue) In each case, whole-brain tissue at embryonic day 16 (E16) was pooled from six mice. Mutant mice carry an early nonsense mutation in Foxp2, which leads to both nonsense-mediated RNA decay and protein instability, resulting in an absence of detectable Foxp2 protein, as confirmed using both N- and C-terminal antibodies (M.G., J.N., and S.E.F., unpublished data). Wild-type and mutant mice were littermates, to maximize the homogeneity of the genomic background. Despite a lack of Foxp2 protein, homozygous mutants show no gross anomalies in anatomy or brain development during embryogenesis. Postnatally, they display developmental delays and reduced cerebellar growth, dying ∼3–4 wk after birth for as-yet unknown reasons (M.G., J.N., and S.E.F., unpublished data). All animal studies were performed conforming to the regulatory standards of the U.K. Home Office, under Project Licence 30/2016.
Purified chromatin was amplified via ligation-mediated PCR in accordance with published protocols.22 Size and purity of DNA was assessed via spectrophotometry and gel electrophoresis.
Two hundred nanograms of amplified immunoprecipitated chromatin or total input DNA was fluorescently labeled with Cy5 or Cy3, respectively, by use of random primers provided in the BioPrime DNA labeling system (Invitrogen), in accordance with the manufacturer's instructions. The labeling reaction was allowed to proceed for 16 h at 37°C, before purification by sodium-acetate precipitation. A total of 2 βg of labeled DNA was hybridized to high-density human promoter arrays (Aviva Biosystems).23 Three biological replicates were performed.
Array images were scanned using the Axon GenePix 4000B. Data were retrieved, and initial quality control was performed using the GenePix Pro 6.0 software package (Molecular Devices). Microarray data analysis was performed using the Limma package for R.24, 25 Print-tip loess normalization and background correction was performed within each array. Data were normalized between arrays by use of quantile normalization, and the median value was calculated from triplicate experiments for each probe, for use in further analyses. Probes that displayed statistically significant differences of abundance (P<.05) were ranked according to both fold change and P value. The P values were adjusted for multiple testing by use of the false-discovery–rate method in the p.adjust package in R.26 All microarray data can be found in the tab-delimited ASCII files of, 2, 3, 4, and 5.
The GOTree Machine (GOTM),27 part of WebGestalt (Web-based gene set analysis toolkit), was used to visualize gene-function relationships. This program queries the Genekey database incorporating the Locuslink, Ensembl, Swiss-Prot, HomoloGene, Unigene, Gene Ontology Consortium, and Affymetrix databases. Statistical significance of overrepresentation in the target gene list of 303 genes was calculated using the entire probe set as a reference data set, via a hypergeometric test, where significance is defined as P<.05. Functional annotation was performed using the Database for Annotation, Visualization, and Integrated Discovery (DAVID).28
Ingenuity pathway analysis software was used to identify interactions between target genes (Ingenuity Systems). All 303 enriched genes with a P value <.05 (Table 1) were included in this analysis, and both direct and indirect interactions were considered. The full set of genes from the array was used as a reference data set.
| Table 1 Genes Displaying Significant Enrichment (P<.05) in FOXP2 High-Throughput Location Analysis |
| Gene | GenBank Accession Number | P | ||
|---|---|---|---|---|
| ABCG2 | NM_004827 | .027 | ||
| ACSL5 | NM_016234 | .0063 | ||
| ACSS2 | NM_018677 | .017 | ||
| ADAM28 | NM_021777 | .022 | ||
| ADMR | NM_007264 | .036 | ||
| AKAP6 | NM_004274 | .031 | ||
| ALDOA | NM_000034 | .0015 | ||
| ARL1 | NM_001177 | .026 | ||
| ARL4A | NM_005738 | .050 | ||
| ATF6 | NM_007348 | .0075 | ||
| ATP1A2 | NM_000702 | .040 | ||
| ATP1B4 | NM_012069 | .044 | ||
| BAIAP3 | NM_003933 | .019 | ||
| BUD31 | NM_003910 | .025 | ||
| C13orf24 | NM_006346 | .021 | ||
| C1orf38 | NM_004848 | .032 | ||
| C20orf24 | NM_018840 | .037 | ||
| CABP1 | NM_031205 | .037 | ||
| CACNG3 | NM_006539 | .0053 | ||
| CALCRL | NM_005795 | .015 | ||
| CCK | NM_000729 | .045 | ||
| CCKAR | NM_000730 | .035 | ||
| CCL19 | NM_006274 | .0088 | ||
| CCNK | NM_003858 | .012 | ||
| CD164 | NM_006016 | .014 | ||
| CD180 | NM_005582 | .0042 | ||
| CD5 | NM_014207 | .015 | ||
| CDH5 | NM_001795 | .0025 | ||
| CER1 | NM_005454 | .0019 | ||
| CGB | NM_033142 | .029 | ||
| CHST11 | NM_018413 | .035 | ||
| CILP | NM_003613 | .026 | ||
| CLEC10A | NM_182906 | .039 | ||
| CLNS1A | NM_001293 | .035 | ||
| CLPX | NM_006660 | .049 | ||
| CNBP | NM_003418 | .041 | ||
| COL8A1 | NM_001850 | .0060 | ||
| COL9A1 | NM_001851 | .047 | ||
| COPS5 | NM_006837 | .048 | ||
| COX11 | NM_004375 | .000099 | ||
| CRISP3 | NM_006061 | .012 | ||
| CRYBA4 | NM_001886 | .027 | ||
| CXCL2 | NM_002089 | .011 | ||
| CYB5B | NM_030579 | .032 | ||
| DCTN2 | NM_006400 | .010 | ||
| DGAT1 | NM_012079 | .0028 | ||
| DLG4 | NM_001365 | .027 | ||
| DLL3 | NM_016941 | .025 | ||
| DPAGT1 | NM_001382 | .034 | ||
| DUSP12 | NM_007240 | .020 | ||
| DYRK1B | NM_004714 | .0062 | ||
| EBI2 | NM_004951 | .00062 | ||
| EBP | NM_006579 | .016 | ||
| EIF3S10 | NM_003750 | .0019 | ||
| ELL2 | NM_012081 | .022 | ||
| ENTPD7 | NM_020354 | .042 | ||
| EPHX2 | NM_001979 | .013 | ||
| EPOR | NM_000121 | .012 | ||
| ERO1L | NM_014584 | .000051 | ||
| F8 | NM_019863 | .046 | ||
| FADD | NM_003824 | .014 | ||
| FBN1 | NM_000138 | .0051 | ||
| FLT1 | NM_002019 | .00037 | ||
| FMO4 | NM_002022 | .0038 | ||
| FOLR1 | NM_016725 | .038 | ||
| FRY | NM_023037 | .015 | ||
| FTH1 | NM_002032 | .010 | ||
| FTSJ2 | NM_013393 | .0055 | ||
| FUT2 | NM_000511 | .023 | ||
| GABBR1 | NM_001470 | .044 | ||
| GAS7 | NM_005890 | .048 | ||
| GBAS | NM_001483 | .041 | ||
| GDF5 | NM_000557 | .036 | ||
| GENX-3414 | NM_003943 | .032 | ||
| GGH | NM_003878 | .049 | ||
| GNAZ | NM_002073 | .0045 | ||
| GPR160 | NM_014373 | .031 | ||
| GPR17 | NM_005291 | .047 | ||
| GPR75 | NM_006794 | .019 | ||
| GRHPR | NM_012203 | .038 | ||
| GUCA1B | NM_002098 | .049 | ||
| HAPLN1 | NM_001884 | .0028 | ||
| HAS1 | NM_001523 | .0019 | ||
| HAT | NM_004262 | .014 | ||
| HIST1H2AG | NM_021064 | .021 | ||
| HNRPK | NM_002140 | .031 | ||
| HOXB6 | NM_156036 | .0023 | ||
| HRSP12 | NM_005836 | .0000062 | ||
| HSPA2 | NM_021979 | .018 | ||
| HSPB7 | NM_014424 | .0022 | ||
| HTRA2 | NM_012103 | .050 | ||
| HUWE1 | NM_031407 | .042 | ||
| HYAL2 | NM_003773 | .012 | ||
| IFI30 | NM_006332 | .00024 | ||
| IGLL1 | NM_020070 | .017 | ||
| IL18 | NM_001562 | .034 | ||
| IL1B | NM_000576 | .042 | ||
| IL4R | NM_000418 | .035 | ||
| ISLR | NM_005545 | .010 | ||
| ITPK1 | NM_014216 | .0071 | ||
| KCNB1 | NM_004975 | .041 | ||
| KCNE1L | NM_012282 | .0079 | ||
| Kifap3 | NM_014970 | .047 | ||
| KLK8 | NM_007196 | .035 | ||
| KRT17 | NM_000422 | .031 | ||
| LBR | NM_002296 | .0036 | ||
| LDHA | NM_005566 | .013 | ||
| LECT1 | NM_007015 | .0054 | ||
| LENEP | NM_018655 | .0085 | ||
| LILRA2 | NM_006866 | .043 | ||
| LILRB5 | NM_006840 | .043 | ||
| LILRP2 | NR_003061 | .017 | ||
| LIM2 | NM_030657 | .044 | ||
| LNPEP | NM_005575 | .00012 | ||
| LTB | NM_002341 | .012 | ||
| LTF | NM_002343 | .020 | ||
| LY6G6E | NM_024123 | .035 | ||
| LYPLA1 | NM_006330 | .033 | ||
| MAD2L2 | NM_006341 | .030 | ||
| MAEA | NM_005882 | .021 | ||
| MAPK14 | NM_001315 | .046 | ||
| MAPK7 | NM_139032 | .0042 | ||
| MAPK8IP1 | NM_005456 | .0021 | ||
| MAPRE3 | NM_012326 | .036 | ||
| MARK2 | NM_004954 | .019 | ||
| MDFI | NM_005586 | .023 | ||
| MEST | NM_002402 | .019 | ||
| MFGE8 | NM_005928 | .045 | ||
| MORF4L2 | NM_012286 | .027 | ||
| MOS | NM_005372 | .044 | ||
| MPO | NM_000250 | .026 | ||
| MPP3 | NM_001932 | .034 | ||
| MPV17 | NM_002437 | .043 | ||
| MYOT | NM_006790 | .0057 | ||
| NCOR2 | NM_006312 | .0013 | ||
| NDUFA2 | NM_002488 | .046 | ||
| NDUFA8 | NM_014222 | .030 | ||
| NEDD8 | NM_006156 | .039 | ||
| NEU2 | NM_005383 | .020 | ||
| NEUROD2 | NM_006160 | .010 | ||
| NEUROG1 | NM_006161 | .018 | ||
| NRTN | NM_004558 | .045 | ||
| NRXN3 | NM_004796 | .016 | ||
| NUDT1 | NM_002452 | .011 | ||
| NXF1 | NM_006362 | .019 | ||
| OPN1SW | NM_001708 | .0046 | ||
| ORC6L | NM_014321 | .025 | ||
| OXR1 | NM_018002 | .037 | ||
| P115 | NM_003715 | .043 | ||
| PAM | NM_000919 | .0084 | ||
| PAX1 | NM_006192 | .0013 | ||
| PAX3 | NM_000438 | .0084 | ||
| PCCA | NM_000282 | .015 | ||
| PCSK1 | NM_000439 | .029 | ||
| PCSK6 | NM_002570 | .013 | ||
| PCYT1B | NM_004845 | .042 | ||
| PDCD8 | NM_004208 | .026 | ||
| PDE1C | NM_005020 | .030 | ||
| PDE4C | NM_000923 | .045 | ||
| PDE6B | NM_000283 | .012 | ||
| PEX1 | NM_000466 | .013 | ||
| PEX16 | NM_057174 | .034 | ||
| PIGC | NM_153747 | .014 | ||
| PKP1 | NM_000299 | .036 | ||
| PLA2G4B | NM_005090 | .046 | ||
| PLA2R1 | NM_007366 | .049 | ||
| PLAUR | NM_002659 | .012 | ||
| PM5 | NM_014287 | .018 | ||
| PMF1 | NM_007221 | .024 | ||
| PNKP | NM_007254 | .030 | ||
| POLS | NM_006999 | .017 | ||
| POU4F3 | NM_002700 | .032 | ||
| PPP2R3A | NM_002718 | .0098 | ||
| PPP2R5D | NM_006245 | .037 | ||
| PRKAG3 | NM_017431 | .046 | ||
| PRSC | NM_006587 | .031 | ||
| PRSS12 | NM_003619 | .023 | ||
| PRSS22 | NM_022119 | .018 | ||
| PRSS8 | NM_002773 | .037 | ||
| PSEN2 | NM_000447 | .013 | ||
| PSMA3 | NM_002788 | .017 | ||
| PSMD1 | NM_002807 | .018 | ||
| PTCH2 | NM_003738 | .026 | ||
| PTGER1 | NM_000955 | .0026 | ||
| PTGER3 | NM_000957 | .021 | ||
| PTK9 | NM_198974 | .0091 | ||
| PYCR1 | NM_153824 | .012 | ||
| RAB18 | NM_021252 | .013 | ||
| RAB27A | NM_004580 | .035 | ||
| RAB5C | NM_004583 | .021 | ||
| RABGGTA | NM_004581 | .016 | ||
| RAD51AP1 | NM_006479 | .014 | ||
| RAI1 | NM_030665 | .015 | ||
| RALA | NM_005402 | .0031 | ||
| RALBP1 | NM_006788 | .0015 | ||
| RARB | NM_000965 | .040 | ||
| RBM4 | NM_002896 | .039 | ||
| RBP2 | NM_004164 | .046 | ||
| RCN2 | NM_002902 | .0051 | ||
| RECQL5 | NM_004259 | .033 | ||
| RFPL3 | NM_006604 | .010 | ||
| RGN | NM_004683 | .041 | ||
| RGS2 | NM_002923 | .047 | ||
| ROR2 | NM_004560 | .033 | ||
| RPL10 | NM_006013 | .023 | ||
| RPL22 | NM_000983 | .0040 | ||
| RPL28 | NM_000991 | .0098 | ||
| RQCD1 | NM_005444 | .035 | ||
| RRAGB | NM_016656 | .048 | ||
| RRP9 | NM_004704 | .011 | ||
| RYR3 | NM_001036 | .021 | ||
| S100A3 | NM_002960 | .028 | ||
| SAS10 | NM_020368 | .050 | ||
| SCGB2A2 | NM_002411 | .030 | ||
| SCRG1 | NM_007281 | .028 | ||
| SCRN1 | NM_014766 | .033 | ||
| SELENBP1 | NM_003944 | .030 | ||
| SEMA3B | NM_004636 | .0071 | ||
| SFRP4 | NM_003014 | .027 | ||
| SFRS11 | NM_004768 | .047 | ||
| SIRT3 | NM_012239 | .0053 | ||
| SLBP | NM_006527 | .032 | ||
| SLC17A3 | NM_006632 | .0093 | ||
| SLC20A1 | NM_005415 | .0047 | ||
| SLC22A14 | NM_004803 | .0099 | ||
| SLC22A3 | NM_021977 | .042 | ||
| SLC25A3 | NM_002635 | .0041 | ||
| SLC2A4 | NM_001042 | .0058 | ||
| SLC4A4 | NM_003759 | .036 | ||
| SLC4A8 | NM_001039960 | .0028 | ||
| SLC5A1 | NM_000343 | .025 | ||
| SLC5A6 | NM_021095 | .026 | ||
| SLIT1 | NM_003061 | .025 | ||
| SMAD3 | NM_005902 | .020 | ||
| SMARCB1 | NM_003073 | .0042 | ||
| SMC2 | NM_006444 | .0022 | ||
| SMCX | NM_004187 | .044 | ||
| SMS | NM_004595 | .038 | ||
| SNFT | NM_018664 | .00025 | ||
| SNRPG | NM_003096 | .020 | ||
| SNW1 | NM_012245 | .016 | ||
| SOCS1 | NM_003745 | .050 | ||
| SOD3 | NM_003102 | .00046 | ||
| SORBS3 | NM_005775 | .0047 | ||
| SOX15 | NM_006942 | .023 | ||
| SOX21 | NM_007084 | .031 | ||
| SPEG | XM_001131579 | .0024 | ||
| SPOCK1 | NM_004598 | .011 | ||
| SPOCK3 | NM_016950 | .018 | ||
| SRD5A2 | NM_000348 | .029 | ||
| SRPK1 | NM_003137 | .018 | ||
| SSX2IP | NM_014021 | .012 | ||
| ST3GAL5 | NM_003896 | .012 | ||
| STC1 | NM_003155 | .0098 | ||
| STC2 | NM_003714 | .042 | ||
| SYK | NM_003177 | .0022 | ||
| SYNJ1 | NM_203446 | .031 | ||
| TACSTD2 | NM_002353 | .020 | ||
| TAGLN | NM_003186 | .0034 | ||
| TCEB1 | NM_005648 | .020 | ||
| TCF12 | NM_207037 | .0020 | ||
| TDO2 | NM_005651 | .0046 | ||
| TG | NM_003235 | .0088 | ||
| TGM2 | NM_004613 | .014 | ||
| THBS1 | NM_003246 | .041 | ||
| THPO | NM_000460 | .028 | ||
| TIAF1 | NM_004740 | .033 | ||
| TIAM1 | NM_003253 | .0013 | ||
| TITF1 | NM_003317 | .024 | ||
| TJP2 | NM_004817 | .026 | ||
| TLL2 | NM_012465 | .0015 | ||
| TMEM4 | NM_014255 | .043 | ||
| TNFRSF14 | NM_003820 | .032 | ||
| TNFSF9 | NM_003811 | .038 | ||
| TNNI1 | NM_003281 | .0038 | ||
| TNS1 | NM_022648 | .034 | ||
| TOPBP1 | NM_007027 | .022 | ||
| TP53AP1 | NM_007233 | .0051 | ||
| TPM2 | NM_003289 | .013 | ||
| TPO | NM_000547 | .0064 | ||
| TPP2 | NM_003291 | .0028 | ||
| TPSD1 | NM_012217 | .032 | ||
| TRAF1 | NM_005658 | .0057 | ||
| TREH | NM_007180 | .030 | ||
| TRIM21 | NM_003141 | .043 | ||
| TRIP13 | NM_004237 | .026 | ||
| TRPA1 | NM_007332 | .0057 | ||
| TUBB2B | NM_178012 | .0057 | ||
| TXNIP | NM_006472 | .043 | ||
| UBE2D2 | NM_181838 | .045 | ||
| UBE2G1 | NM_003342 | .036 | ||
| UBN1 | NM_016936 | .030 | ||
| VAMP2 | NM_014232 | .0074 | ||
| VASP | NM_003370 | .049 | ||
| VLDLR | NM_003383 | .026 | ||
| YRDC | NM_024640 | .038 | ||
| ZFP95 | NM_014569 | .039 | ||
| ZNF259 | NM_003904 | .036 | ||
| ZNF331 | NM_018555 | .030 | ||
| ZNF384 | NM_133476 | .032 | ||
| ZNF74 | NM_003426 | .030 | ||
| ZNF76 | NM_003427 | .039 | ||
The top 100 statistically significant probe sequences were assessed for the presence of known FOX family binding sites by use of the Emboss FUZZNUC nucleic acid–pattern search tool. Predicted sites for FOXP2 binding were based on previously published consensus binding sites for FOX family members or recently reported sequences bound by FOXP2. Sites were defined as follows: for FOXP2, (A)ATTTG(T) (i.e., AATTTG or ATTTGT)29, 30; for FOXP, TATTTRT14; and, for FOX, TRTTKRY,31 where R = A or G, K = T or G, and Y = T or C. When a site fell into two classes of motifs, only the most specific level of classification was used—that is, sites were preferentially categorized as FOXP2, FOXP, or FOX consensus sites, in that order. Significance was calculated using χ2 tests comparing frequencies to counts of predicted sites in permuted probe sequences from the top 100 statistically significant probe sequences. When potential sites for hetero- or homodimerization were considered, only nonoverlapping sites conforming to the exact consensus that lay within 100 bp of each other were included.
Sequences were assessed for the presence of overrepresented motifs by use of the Multiple Em for Motif Elucidation (MEME) and/or Motif Alignment and Search Tool (MAST) programs.32, 33 Top-scoring matrices were investigated for matches to any known binding-site matrices by use of the TRANSFAC database. Sequences were investigated for coincident motifs that could potentially interact with the function of FOX family binding sites. A total of 542 binding-site matrices from TRANSFAC were used to query the enriched probe sequence set (303 genes) (Table 1), as well as the set of sequences from the whole array as a reference data set. Statistical significance (P<.05) was assessed using Student's t test, to determine the overrepresentation of the binding sites present in the enriched probe data set compared with the whole array data set.
RNA was extracted from cells or tissue harvested in TRIzol reagent by use of the QIAGEN RNeasy kit. Human cell-based experiments exploited SH-SY5Y cells transfected with either FOXP2 or empty control vectors. For stable transfectants, multiple independent passages of a single clone were used (see “ Cell Culture and Reagents” section), whereas transient transfectants involved separately transfected clones. For the latter, cells were harvested 48 h after transfection for RT-PCR analyses. In vivo mouse experiments used dissected brain tissue from E16 embryos, including mutant mice lacking Foxp2 protein and wild-type littermate controls. Reverse transcription was performed with Superscript III reverse transcriptase (Invitrogen) in accordance with the manufacturer's instructions. In brief, 1 βg RNA was primed via incubation with 100 ng of random primers and 0.8 mM deoxynucleotide triphosphates (dNTPs) at 65°C for 5 min and then on ice for 1 min. Reverse transcription was mediated via the addition of 200 U of Superscript III Reverse Transcriptase (Invitrogen) and 20 U of Superase-In RNase Inhibitor (Ambion), in the presence of first-strand buffer (Invitrogen).
Primers specific for candidate genes and for the control housekeeping gene GAPDH/Gapdh (glyceraldehyde 3-phosphate dehydrogenase) were designed using PrimerBank.34 Human and mouse primers were as given in Table 2. PCRs used SYBR Green supermix (Bio-Rad), including 0.2 βM each of forward and reverse primers and 1 βl of cDNA template prepared as described above. Quantitative PCRs were performed on the iQ5 thermal cycler real-time PCR detection system (Bio-Rad) in accordance with the manufacturer's instructions. Reaction conditions were (1) 95°C for 3 min, (2) 95°C for 15 s, (3) 60°C for 30 s, and (4) 72°C for 30 s, then (5) repeat from step 2 for 49 cycles, followed by (6) 95°C for 1 min, and (7) 55°C for 30 s. Melting-curve analysis was performed to assess the specificity of the amplification. Data analysis was performed using iCycler software (Bio-Rad). Quantification was calculated using the comparative CT method.35 Fold changes are reported in response to FOXP2 expression (transient or stable) compared with cells transfected with an empty vector, following normalization to an internal control, the GAPDH housekeeping gene. Reported fold changes for in vitro experiments are the mean of comparisons between seven (stable) or six (transient) cDNA preparations. In vivo fold changes are reported as the mean of comparisons between cDNA preparations from five wild-type and five knockout littermates. Data are expressed as mean±SEM. Statistical significance was assessed using unpaired t tests (two-tailed).
| Table 2 qRT-PCR Primers |
| Primer (5′→3′) | ||||
|---|---|---|---|---|
| Gene | Forward | Reverse | ||
| SLC17A3 | GCCCTCGTCTTACATTTCTGC | AGGAATCATTGAGCTGGGATTG | ||
| CALCRL | AAGACCCCATTCAACAAGCAG | CCAGTTTCCATCTTGGTCACAG | ||
| LNPEP | TTCACCAATGATCGGCTTCAG | CTCCATCTCATGCTCACCAAG | ||
| HSPB7 | GAGCATGTTTTCCGATGACTTTG | GGTGACAATGATGTCTTCAGGTG | ||
| PSEN2 | GAGGATGGAGAGAACACTGCC | CCACTACAGACATAGCGGTCAG | ||
| COX11 | GCGTTCCTTTCTGTGGCTG | CCACCTCAGTCCTCTCTCG | ||
| PM5 | GGTGGCTTCGTCAAGTCGG | GGGCACAGTCTGTCTGGTAT | ||
| RCN2 | TTGGACTCAGATGGCTTTCTCA | TCCCAAGTCACAGTATCATCACT | ||
| CD164 | CCCTCCCCTTCTACAACTTCC | TGAGGTTGGAGTCACAGTGTTAT | ||
| CER1 | CCTGCCTCTAGGAAAGACCAC | TGGCACTGCGACAAACAGA | ||
| SLC22A14 | GTTTGCTGACCACTTCGTGTT | CCATTGGGTGCTTGGGGTAT | ||
| ERO1L | GGCTGGGGATTCTTGTTTGG | AGTAACCACTAACCTGGCAGA | ||
| MAPK8IP1 | TGTGCGACTAGAGGCCACT | AGGGTCTGGATCGGAGCTG | ||
| SYK | TGGTCAGCGGGTGGAATAATC | GGGCTCTCGTACACCTCTG | ||